Review



4 kb ecori dna segment  (TaKaRa)


Bioz Verified Symbol TaKaRa is a verified supplier
Bioz Manufacturer Symbol TaKaRa manufactures this product  
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 99
      Buy from Supplier

    Structured Review

    TaKaRa 4 kb ecori dna segment
    4 Kb Ecori Dna Segment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 16041 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kb+dna+segment/EcoR+I/pm12370121-55-1-49
    Average 99 stars, based on 16041 article reviews
    4 kb ecori dna segment - by Bioz Stars, 2026-11
    99/100 stars

    Images

    Related Articles

    Amplification:

    Article Title: Characterization, sequencing, and expression of the genes encoding a reactivating factor for glycerol-inactivated adenosylcobalamin-dependent diol dehydratase.
    Article Snippet: .. A 2.3-kb DNA segment of pSTV28 (Takara Shuzo Co. Ltd., Kyoto, Japan) was amplified by PCR using Vent DNA polymerase (New England Biolabs) and oligonucleotide primers TCAAGCTTTGGGAGGCAGAATAAATGATCATATC and AGCTCGGGTAGCCCGCCTAATGAGCGGGCTTTTTTTTATGAGAATTACAACTTATATCGTATG (the HindIII and AvaI sites and the trpA transcriptional terminator are underlined). ..

    Polymerase Chain Reaction:

    Article Title: Characterization, sequencing, and expression of the genes encoding a reactivating factor for glycerol-inactivated adenosylcobalamin-dependent diol dehydratase.
    Article Snippet: .. A 2.3-kb DNA segment of pSTV28 (Takara Shuzo Co. Ltd., Kyoto, Japan) was amplified by PCR using Vent DNA polymerase (New England Biolabs) and oligonucleotide primers TCAAGCTTTGGGAGGCAGAATAAATGATCATATC and AGCTCGGGTAGCCCGCCTAATGAGCGGGCTTTTTTTTATGAGAATTACAACTTATATCGTATG (the HindIII and AvaI sites and the trpA transcriptional terminator are underlined). ..



    Similar Products

    kb dna segment  (Thermo Fisher)
    99
    Thermo Fisher kb dna segment
    Kb Dna Segment, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kb+dna+segment/DNA/pm37580306-42-26-56
    Average 99 stars, based on 1 article reviews
    kb dna segment - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    239 kb chromosomal dna segment  (ATCC)
    93
    ATCC 239 kb chromosomal dna segment
    239 Kb Chromosomal Dna Segment, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kb+dna+segment/Win+Mec/pmc02830990-59-26-11
    Average 93 stars, based on 1 article reviews
    239 kb chromosomal dna segment - by Bioz Stars, 2026-11
    93/100 stars
    		  Buy from Supplier
    4 kb ecori dna segment  (TaKaRa)
    99
    TaKaRa 4 kb ecori dna segment
    4 Kb Ecori Dna Segment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kb+dna+segment/EcoR+I/pm12370121-55-1-49
    Average 99 stars, based on 1 article reviews
    4 kb ecori dna segment - by Bioz Stars, 2026-11
    99/100 stars
    		  Buy from Supplier
    kb dna segment  (TaKaRa)
    94
    TaKaRa kb dna segment
    Kb Dna Segment, supplied by TaKaRa, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/kb+dna+segment/pSTV+28+DNA/pm09405397-69-1-6
    Average 94 stars, based on 1 article reviews
    kb dna segment - by Bioz Stars, 2026-11
    94/100 stars
    		  Buy from Supplier

    Image Search Results